diff --git a/pipelines/skylab/multiome/Multiome.changelog.md b/pipelines/skylab/multiome/Multiome.changelog.md
index f0b69bdcd5..a2737a1c95 100644
--- a/pipelines/skylab/multiome/Multiome.changelog.md
+++ b/pipelines/skylab/multiome/Multiome.changelog.md
@@ -1,14 +1,19 @@
-# 3.4.5
+# 5.0.0
+2024-05-20 (Date of Last Commit)
+
+* Updated SnapATAC2 docker to SnapATAC2 v2.6.3; this impacts the workflow output metrics
+
+# 4.0.2
 2024-05-14 (Date of Last Commit)
 
 * Updated the Paired-tag Demultiplex task so that some intermediate input names have been renamed; this change does not impact the Multiome workflow
 
-# 3.4.4
+# 4.0.1
 2024-05-10 (Date of Last Commit)
 
 * Updated the Paired-tag Demultiplex task; this change does not impact the Multiome workflow
 
-# 3.4.3
+# 4.0.0
 2024-04-24 (Date of Last Commit)
 
 * Updated the input parameters for STARsolo in STARsoloFastq task. These include the parameters: soloCBmatchWLtype, soloUMIdedup and soloUMIfiltering
diff --git a/pipelines/skylab/multiome/Multiome.wdl b/pipelines/skylab/multiome/Multiome.wdl
index 526381b707..e6cd1017a0 100644
--- a/pipelines/skylab/multiome/Multiome.wdl
+++ b/pipelines/skylab/multiome/Multiome.wdl
@@ -7,7 +7,7 @@ import "https://raw.githubusercontent.com/broadinstitute/CellBender/v0.3.0/wdl/c
 
 workflow Multiome {
 
-    String pipeline_version = "3.4.5"
+    String pipeline_version = "5.0.0"
 
     input {
         String input_id
@@ -79,10 +79,10 @@ workflow Multiome {
             read3_fastq_gzipped = atac_r3_fastq,
             input_id = input_id + "_atac",
             tar_bwa_reference = tar_bwa_reference,
-            annotations_gtf = annotations_gtf,
             chrom_sizes = chrom_sizes,
             whitelist = atac_whitelist,
             adapter_seq_read1 = adapter_seq_read1,
+            annotations_gtf = annotations_gtf,
             adapter_seq_read3 = adapter_seq_read3
     }
     call H5adUtils.JoinMultiomeBarcodes as JoinBarcodes {
diff --git a/pipelines/skylab/multiome/atac.changelog.md b/pipelines/skylab/multiome/atac.changelog.md
index 54948b799f..7478a49e0d 100644
--- a/pipelines/skylab/multiome/atac.changelog.md
+++ b/pipelines/skylab/multiome/atac.changelog.md
@@ -1,3 +1,8 @@
+# 2.0.0
+2024-05-20 (Date of Last Commit)
+
+* Updated SnapATAC2 docker to SnapATAC2 v2.6.3; this impacts the workflow output metrics
+
 # 1.2.3
 2024-05-14 (Date of Last Commit)
 
diff --git a/pipelines/skylab/multiome/atac.wdl b/pipelines/skylab/multiome/atac.wdl
index e8fa467264..e3a63d7e4c 100644
--- a/pipelines/skylab/multiome/atac.wdl
+++ b/pipelines/skylab/multiome/atac.wdl
@@ -29,10 +29,10 @@ workflow ATAC {
     Int mem_size_bwa = 512
     String cpu_platform_bwa = "Intel Ice Lake"
 
-    # GTF for SnapATAC2 to calculate TSS sites of fragment file
-    File annotations_gtf
     # Text file containing chrom_sizes for genome build (i.e. hg38)
     File chrom_sizes
+    #File for annotations for calculating ATAC TSSE 
+    File annotations_gtf
     # Whitelist
     File whitelist
 
@@ -41,7 +41,7 @@ workflow ATAC {
     String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG"
   }
 
-  String pipeline_version = "1.2.3"
+  String pipeline_version = "2.0.0"
 
   parameter_meta {
     read1_fastq_gzipped: "read 1 FASTQ file as input for the pipeline, contains read 1 of paired reads"
@@ -436,12 +436,12 @@ task BWAPairedEndAlignment {
 task CreateFragmentFile {
   input {
     File bam
-    File annotations_gtf
     File chrom_sizes
+    File annotations_gtf
     Boolean preindex
     Int disk_size = 500
     Int mem_size = 16
-    Int nthreads = 1
+    Int nthreads = 4
     String cpuPlatform = "Intel Cascade Lake"
   }
 
@@ -449,8 +449,8 @@ task CreateFragmentFile {
 
   parameter_meta {
     bam: "Aligned bam with CB in CB tag. This is the output of the BWAPairedEndAlignment task."
-    annotations_gtf: "GTF for SnapATAC2 to calculate TSS sites of fragment file."
     chrom_sizes: "Text file containing chrom_sizes for genome build (i.e. hg38)."
+    annotations_gtf: "GTF for SnapATAC2 to calculate TSS sites of fragment file."
     disk_size: "Disk size used in create fragment file step."
     mem_size: "The size of memory used in create fragment file."
   }
@@ -461,10 +461,10 @@ task CreateFragmentFile {
     python3 <<CODE
 
     # set parameters
-    atac_gtf = "~{annotations_gtf}"
     bam = "~{bam}"
     bam_base_name = "~{bam_base_name}"
     chrom_sizes = "~{chrom_sizes}"
+    atac_gtf = "~{annotations_gtf}"
     preindex = "~{preindex}"
 
     # calculate chrom size dictionary based on text file
@@ -477,6 +477,7 @@ task CreateFragmentFile {
     # use snap atac2
     import snapatac2.preprocessing as pp
     import snapatac2 as snap
+    import anndata as ad
 
     # extract CB or BB (if preindex is true) tag from bam file to create fragment file
     if preindex == "true":
@@ -487,13 +488,18 @@ task CreateFragmentFile {
 
     # calculate quality metrics; note min_num_fragments and min_tsse are set to 0 instead of default
     # those settings allow us to retain all barcodes
-    pp.import_data("~{bam_base_name}.fragments.tsv", file="~{bam_base_name}.metrics.h5ad", chrom_size=chrom_size_dict, gene_anno="~{annotations_gtf}", min_num_fragments=0, min_tsse=0)
+    pp.import_data("~{bam_base_name}.fragments.tsv", file="temp_metrics.h5ad", chrom_sizes=chrom_size_dict, min_num_fragments=0)
+    atac_data = ad.read_h5ad("temp_metrics.h5ad")
+    # calculate tsse metrics
+    snap.metrics.tsse(atac_data, atac_gtf)
+    # Write new atac file
+    atac_data.write_h5ad("~{bam_base_name}.metrics.h5ad")
 
     CODE
   >>>
 
   runtime {
-    docker: "us.gcr.io/broad-gotc-prod/snapatac2:1.0.4-2.3.1"
+    docker: "us.gcr.io/broad-gotc-prod/snapatac2:1.0.9-2.6.3-1715865353"
     disks: "local-disk ${disk_size} SSD"
     memory: "${mem_size} GiB"
     cpu: nthreads
diff --git a/pipelines/skylab/optimus/Optimus.changelog.md b/pipelines/skylab/optimus/Optimus.changelog.md
index 1b6844d493..dbbf6814ab 100644
--- a/pipelines/skylab/optimus/Optimus.changelog.md
+++ b/pipelines/skylab/optimus/Optimus.changelog.md
@@ -1,4 +1,9 @@
-# 6.6.2
+# 7.1.0
+2024-05-20 (Date of Last Commit)
+
+* Updated SnapATAC2 docker to SnapATAC2 v2.6.3; this does not impact the Optimus workflow
+
+# 7.0.0
 2024-04-24 (Date of Last Commit)
 
 * Updated the input parameters for STARsolo in STARsoloFastq task. These include the parameters: soloCBmatchWLtype, soloUMIdedup and soloUMIfiltering
diff --git a/pipelines/skylab/optimus/Optimus.wdl b/pipelines/skylab/optimus/Optimus.wdl
index 59c2610b97..2163740eb9 100644
--- a/pipelines/skylab/optimus/Optimus.wdl
+++ b/pipelines/skylab/optimus/Optimus.wdl
@@ -65,7 +65,7 @@ workflow Optimus {
   # version of this pipeline
 
 
-  String pipeline_version = "6.6.2"
+  String pipeline_version = "7.1.0"
 
 
   # this is used to scatter matched [r1_fastq, r2_fastq, i1_fastq] arrays
diff --git a/pipelines/skylab/paired_tag/PairedTag.changelog.md b/pipelines/skylab/paired_tag/PairedTag.changelog.md
index 04597010ea..3638009b7d 100644
--- a/pipelines/skylab/paired_tag/PairedTag.changelog.md
+++ b/pipelines/skylab/paired_tag/PairedTag.changelog.md
@@ -1,13 +1,16 @@
-# 0.7.0 
-2024-05016 (Date of Last Commit)
+# 0.7.0
+2024-05-20
+
+* Updated SnapATAC2 docker and tasks to run SnapATAC v2.6.3 
+* Added testing infrastructure for paired-tag plumbing data and example data sets
 
-* Added Paired-tag testing infrastructure and example test inputs
 
 # 0.6.1
 2024-05-14 (Date of Last Commit)
 
 * Updated the demultiplex task so that some intermediate input names have been renamed. There is no change to the outputs.
 
+
 # 0.6.0
 2024-05-10 (Date)
 
diff --git a/pipelines/skylab/paired_tag/PairedTag.wdl b/pipelines/skylab/paired_tag/PairedTag.wdl
index c19dd233fa..5e5a0d667b 100644
--- a/pipelines/skylab/paired_tag/PairedTag.wdl
+++ b/pipelines/skylab/paired_tag/PairedTag.wdl
@@ -86,11 +86,11 @@ workflow PairedTag {
             read3_fastq_gzipped = demultiplex.fastq3,
             input_id = input_id + "_atac",
             tar_bwa_reference = tar_bwa_reference,
-            annotations_gtf = annotations_gtf,
             chrom_sizes = chrom_sizes,
             whitelist = atac_whitelist,
             adapter_seq_read1 = adapter_seq_read1,
             adapter_seq_read3 = adapter_seq_read3,
+            annotations_gtf = annotations_gtf,
             preindex = preindex
     }
 
diff --git a/pipelines/skylab/slideseq/SlideSeq.changelog.md b/pipelines/skylab/slideseq/SlideSeq.changelog.md
index 3910f51df0..52672034ec 100644
--- a/pipelines/skylab/slideseq/SlideSeq.changelog.md
+++ b/pipelines/skylab/slideseq/SlideSeq.changelog.md
@@ -1,3 +1,8 @@
+# 3.1.6
+2024-05-20 (Date of Last Commit)
+
+* Updated SnapATAC2 docker to SnapATAC2 v2.6.3; this does not impact the SlideSeq workflow
+
 # 3.1.5
 2024-04-12 (Date of Last Commit)
 
diff --git a/pipelines/skylab/slideseq/SlideSeq.wdl b/pipelines/skylab/slideseq/SlideSeq.wdl
index ca41374852..2e9346de98 100644
--- a/pipelines/skylab/slideseq/SlideSeq.wdl
+++ b/pipelines/skylab/slideseq/SlideSeq.wdl
@@ -23,7 +23,7 @@ import "../../../tasks/skylab/MergeSortBam.wdl" as Merge
 
 workflow SlideSeq {
 
-    String pipeline_version = "3.1.5"
+    String pipeline_version = "3.1.6"
 
     input {
         Array[File] r1_fastq
diff --git a/tasks/skylab/H5adUtils.wdl b/tasks/skylab/H5adUtils.wdl
index 18fed45fc1..924b19a770 100644
--- a/tasks/skylab/H5adUtils.wdl
+++ b/tasks/skylab/H5adUtils.wdl
@@ -223,6 +223,7 @@ task JoinMultiomeBarcodes {
     # import anndata to manipulate h5ad files
     import anndata as ad
     import pandas as pd
+    import snapatac2 as snap
     print("Reading ATAC h5ad:")
     print("~{atac_h5ad}")
     print("Read ATAC fragment file:")
@@ -234,7 +235,7 @@ task JoinMultiomeBarcodes {
     atac_tsv = pd.read_csv("~{atac_fragment}", sep="\t", names=['chr','start', 'stop', 'barcode','n_reads'])
     whitelist_gex = pd.read_csv("~{gex_whitelist}", header=None, names=["gex_barcodes"])
     whitelist_atac = pd.read_csv("~{atac_whitelist}", header=None, names=["atac_barcodes"])
-
+    
     # get dataframes
     df_atac = atac_data.obs
     df_gex = gex_data.obs
@@ -261,6 +262,7 @@ task JoinMultiomeBarcodes {
     # set gene_data.obs to new dataframe
     print("Setting Optimus obs to new dataframe")
     gex_data.obs = df_gex
+
     # write out the files
     gex_data.write("~{gex_base_name}.h5ad")
     atac_data.write_h5ad("~{atac_base_name}.h5ad")
@@ -277,7 +279,7 @@ task JoinMultiomeBarcodes {
   >>>
 
   runtime {
-    docker: "us.gcr.io/broad-gotc-prod/snapatac2:1.0.4-2.3.1-1700590229"
+    docker: "us.gcr.io/broad-gotc-prod/snapatac2:1.0.9-2.6.3-1715865353"
     disks: "local-disk ~{disk} HDD"
     memory: "${machine_mem_mb} MiB"
     cpu: nthreads
diff --git a/tasks/skylab/PairedTagUtils.wdl b/tasks/skylab/PairedTagUtils.wdl
index ca5b6cf885..e11a5e9d3d 100644
--- a/tasks/skylab/PairedTagUtils.wdl
+++ b/tasks/skylab/PairedTagUtils.wdl
@@ -227,11 +227,13 @@ task ParseBarcodes {
     # import anndata to manipulate h5ad files
     import anndata as ad
     import pandas as pd
+    import snapatac2 as snap    
     print("Reading ATAC h5ad:")
     atac_data = ad.read_h5ad("~{atac_h5ad}")
     print("Reading ATAC fragment file:")
     test_fragment = pd.read_csv("~{atac_fragment}", sep="\t", names=['chr','start', 'stop', 'barcode','n_reads'])
-      
+
+
     # Separate out CB and preindex in the h5ad and identify sample barcodes assigned to more than one cell barcode
     print("Setting preindex and CB columns in h5ad")
     df_h5ad = atac_data.obs
@@ -271,7 +273,7 @@ task ParseBarcodes {
   >>>
 
   runtime {
-      docker: "us.gcr.io/broad-gotc-prod/snapatac2:1.0.4-2.3.1-1700590229"
+      docker: "us.gcr.io/broad-gotc-prod/snapatac2:1.0.9-2.6.3-1715865353"
       disks: "local-disk ~{disk} HDD"
       memory: "${machine_mem_mb} MiB"
       cpu: nthreads