error message

[amitpande74]

HI,
I am getting this error everytime I run the command
(base) amit@amit-X705UDR:/Desktop/felix/seeq-v1_1_2-x86_64_linux$ ./seeq -b -m test.txt out.fasta
error in 'seeqNew()'; Incorrect pattern (illegal character)
:(base) amit@amit-X705UDR:/Desktop/felix/seeq-v1_1_2-x86_64_linux$ ./seeq -a -i test.txt out.fasta
error in 'seeqNew()'; Incorrect pattern (illegal character)
:(base) amit@amit-X705UDR:~/Desktop/felix/seeq-v1_1_2-x86_64_linux$ ./seeq -a -i out.fasta
error in 'seeqNew()'; Incorrect pattern (illegal character)

Kindly point out where I am wrong.
my pattern file looks like this:
TGTATGTAAACTTCCGACTTCAACTGTA
TGTATGTAAACTT
CCGACTTCAACTGTA
I installed seeq as per the instructions. But there are no examples shown how to run this. Kindly let me know.

[gui11aume]

Hi, can you explain what you are trying to do? For instance, what are test.txt and out.fasta?

The patterns are missing from your command lines. Assuming that test.txt contains some DNA sequences, you should try something like

./seeq TGTATGTAAACTTCCGACTTCAACTGTA text.txt

[amitpande74]

I have a transposon sequence tagged with gDNA and I want to find out that in the analysis in the fastq files. So test.txt file has the sequences from the transposon and out.fasta is the fasta file (while I converted from fastq).
Kindly let me know, where I am going wrong.
regards.

[ezorita]

Hi Amit,

the pattern sequences to be matched must be passed directly as a positional argument as @gui11aume pointed out. If you need to match three different sequences you can run seeq thrice on your fastq file, once for each pattern.