weka511#109 continued

BA5I.py

@@ -1,3 +1,5 @@
+#!/usr/bin/env python
+
 #    Copyright (C) 2019 Greenweaves Software Limited
 #
 #    This is free software: you can redistribute it and/or modify
@@ -19,10 +21,9 @@
 
 if __name__=='__main__':
     from helpers import create_strings
-    
+
     strings  = create_strings('ba5i',ext=1)
-    d,s1,t1  = overlap_assignment(strings[0],strings[1])      
+    d,s1,t1  = overlap_assignment(strings[0],strings[1])
     print ('{0}'.format(d))
     print (s1)
-    print (t1)    
-
+    print (t1)

BA5J.py

@@ -1,3 +1,5 @@
+#!/usr/bin/env python
+
 #    Copyright (C) 2019 Greenweaves Software Limited
 #
 #    This is free software: you can redistribute it and/or modify
@@ -22,14 +24,14 @@ def ba5j(s,t):
     return score,''.join(s1),''.join(t1)
 
 if __name__=='__main__':
-    from helpers import create_strings    
+    from helpers import create_strings
 
     strings  = create_strings('ba5j',ext=7)
     score,s,t=ba5j(strings[0],strings[1])
     print (score)
     print (s)
-    print (t)        
+    print (t)
     with open('ba5j.txt','w') as o:
         o.write('{0}\n'.format(score))
         o.write('{0}\n'.format(s))
-        o.write('{0}\n'.format(t))
+        o.write('{0}\n'.format(t))

BA5K.py

@@ -1,3 +1,5 @@
+#!/usr/bin/env python
+
 #    Copyright (C) 2019-2020 Greenweaves Software Limited
 #
 #    This is free software: you can redistribute it and/or modify
@@ -28,26 +30,26 @@
     parser.add_argument('--extra',     default=False, action='store_true', help='process extra dataset')
     parser.add_argument('--rosalind', default=False, action='store_true', help='process Rosalind dataset')
     args = parser.parse_args()
-    
+
     if args.sample:
         print (FindMiddleEdge('PLEASANTLY','MEASNLY'))
         # (4, 3) (5, 4)
-        
-    if args.extra:      
+
+    if args.extra:
         Input,Expected = read_strings(f'data/middle_edge.txt',init=0)
         ((i,j),(k,l))  = FindMiddleEdge(Input[0],Input[1])
         print (f'Calculated: (({i},{j}),({k},{l}))')
         print (f'Expected {Expected[0]}')
         # Expect (512,510)(513,511)
-        
+
     if args.rosalind:
         Input  = read_strings(f'data/rosalind_{os.path.basename(__file__).split(".")[0]}.txt')
         ((i,j),(k,l))  = FindMiddleEdge(Input[0],Input[1])
         print (f'({i},{j}) ({k},{l})')
         with open(f'{os.path.basename(__file__).split(".")[0]}.txt','w') as f:
             f.write(f'({i},{j}) ({k},{l})\n')
-                
+
     elapsed = time.time() - start
     minutes = int(elapsed/60)
     seconds = elapsed - 60*minutes
-    print (f'Elapsed Time {minutes} m {seconds:.2f} s') 
+    print (f'Elapsed Time {minutes} m {seconds:.2f} s')

BA5L.py

@@ -1,3 +1,5 @@
+#!/usr/bin/env python
+
 #    Copyright (C) 2019-2020 Greenweaves Software Limited
 #
 #    This is free software: you can redistribute it and/or modify
@@ -34,21 +36,21 @@
 def alignUsingLinearSpace(v,w,
                           replace_score = substitution_matrices.load("BLOSUM62"),
                           indel_cost    = 5):
-    
+
     def isRightOrDownRight(midEdge):
         return midEdge==RIGHT or midEdge==DOWNRIGHT
-    
+
     def isDownOrDownRight(midEdge):
         return midEdge==DOWN or midEdge==DOWNRIGHT
-    
+
     # MiddleNodeAndEdge
     #
     # An adapter which replaces MiddleNode and MiddleEdge in the pseudocode, and calls FindMiddleEdge
     def MiddleNodeAndEdge(top, bottom, left, right):
         ((i1,j1),(i2,j2)) = FindMiddleEdge(v[top:bottom],w[left:right],replace_score=replace_score,indel_cost=indel_cost)
         direction         = RIGHT if i1==i2 else DOWN if j1==j2 else DOWNRIGHT
         return j1,direction
-    
+
     # LinearSpaceAlignment
     #
     # Find longest path between a substring of v[top] v[bottom-1]
@@ -58,29 +60,29 @@ def MiddleNodeAndEdge(top, bottom, left, right):
     #         bottom
     #         left
     #         right
-    
+
     def  LinearSpaceAlignment(top, bottom, left, right):
         if left==right:
             return indel_cost*(bottom - top)
         if top==bottom:
             return indel_cost*(right-left)
         middle           = (left + right)//2
         midNode,midEdge  = MiddleNodeAndEdge(top, bottom, left, right)
-  
+
         LinearSpaceAlignment(top, midNode, left, middle)
         # output midEdge
         if isRightOrDownRight(midEdge):
             middle += 1
         if isDownOrDownRight(midEdge):
             midNode+= 1
-        LinearSpaceAlignment(midNode, bottom, middle, right) 
-        
+        LinearSpaceAlignment(midNode, bottom, middle, right)
+
     RIGHT     = 0
     DOWN      = 1
     DOWNRIGHT = 2
     LinearSpaceAlignment(0,len(v)+1,0,len(w)+1)
-        
-    
+
+
 if __name__=='__main__':
     start = time.time()
     parser = argparse.ArgumentParser('BA5L.py Align Two Strings Using Linear Space')
@@ -90,20 +92,20 @@ def  LinearSpaceAlignment(top, bottom, left, right):
     args = parser.parse_args()
     if args.sample:
         print (alignUsingLinearSpace('PLEASANTLY','MEANLY'))
-     
+
     if args.extra:
         Input,Expected             = read_strings(f'data/linear_space_alignment.txt',init=0)
         print (alignUsingLinearSpace(Input[0],Input[1]))
-        
+
     if args.rosalind:
         Input  = read_strings(f'data/rosalind_{os.path.basename(__file__).split(".")[0]}.txt')
- 
+
         Result = None
         print (Result)
         with open(f'{os.path.basename(__file__).split(".")[0]}.txt','w') as f:
             for line in Result:
                 f.write(f'{line}\n')
-                
+
     elapsed = time.time() - start
     minutes = int(elapsed/60)
-    seconds = elapsed - 60*minutes    
+    seconds = elapsed - 60*minutes

BA5M.py

@@ -1,3 +1,5 @@
+#!/usr/bin/env python
+
 #    Copyright (C) 2019 Greenweaves Software Limited
 #
 #    This is free software: you can redistribute it and/or modify
@@ -13,33 +15,32 @@
 #    You should have received a copy of the GNU General Public License
 #    along with GNU Emacs.  If not, see <http://www.gnu.org/licenses/>
 
-# BA5M.py Find a Highest-Scoring Multiple Sequence Alignment 
+# BA5M.py Find a Highest-Scoring Multiple Sequence Alignment
 
 from align import FindHighestScoringMultipleSequenceAlignment
 
 
 
 
 if __name__=='__main__':
-    from helpers import create_strings    
+    from helpers import create_strings
     s,u,v,w = FindHighestScoringMultipleSequenceAlignment('ATATCCG','TCCGA','ATGTACTG')
     print (s)
     print (u)
     print (v)
     print (w)
-    
+
     s1,u1,v1,w1 = FindHighestScoringMultipleSequenceAlignment('TGTTTAAAAATGTCCGCAACCATTTC',
                                                               'GATATAAAACAGGGATAACTGCAATGG',
                                                               'CCTGCTACTTTATGCCGTCTCCATATGCG')
     print (s1)
     print (u1)
     print (v1)
-    print (w1) 
-    
+    print (w1)
+
     ss=create_strings(ext=3)
     s2,u2,v2,w2 = FindHighestScoringMultipleSequenceAlignment(ss[0],ss[1],ss[2])
     print (s2)
     print (u2)
     print (v2)
-    print (w2)    
-
+    print (w2)

BA6A.py

@@ -1,3 +1,5 @@
+#!/usr/bin/env python
+
 #    Copyright (C) 2019-2021 Greenweaves Software Limited
 #
 #    This is free software: you can redistribute it and/or modify
@@ -43,8 +45,8 @@ def f(p):
             for permutation in GreedySorting(get_permutation(Input[0]),signed=True):
                 print (format(permutation))
                 f.write(f'{format(permutation)}\n')
-        
+
     elapsed = time.time() - start
     minutes = int(elapsed/60)
     seconds = elapsed - 60*minutes
-    print (f'Elapsed Time {minutes} m {seconds:.2f} s')  
+    print (f'Elapsed Time {minutes} m {seconds:.2f} s')

BA6B.py

@@ -1,3 +1,5 @@
+#!/usr/bin/env python
+
 #    Copyright (C) 2019-2021 Greenweaves Software Limited
 #
 #    This is free software: you can redistribute it and/or modify
@@ -13,7 +15,7 @@
 #    You should have received a copy of the GNU General Public License
 #    along with this program.  If not, see <http://www.gnu.org/licenses/>
 #
-#    BA6B Compute the Number of Breakpoints in a Permutation 
+#    BA6B Compute the Number of Breakpoints in a Permutation
 
 import argparse
 import os
@@ -29,15 +31,15 @@
      parser.add_argument('--sample',   default=False, action='store_true', help='process sample dataset')
      parser.add_argument('--rosalind', default=False, action='store_true', help='process Rosalind dataset')
      args = parser.parse_args()
-     if args.sample:   
+     if args.sample:
           print (getBreakPoints([+3, +4, +5, -12, -8, -7, -6, +1, +2, +10, +9, -11, +13, +14]))
-          
+
      if args.rosalind:
           Input  = read_strings(f'data/rosalind_{os.path.basename(__file__).split(".")[0]}.txt')
           Result = getBreakPoints(get_permutation(Input[0]))
           print (Result)
-          
+
      elapsed = time.time() - start
      minutes = int(elapsed/60)
      seconds = elapsed - 60*minutes
-     print (f'Elapsed Time {minutes} m {seconds:.2f} s')       
+     print (f'Elapsed Time {minutes} m {seconds:.2f} s')

BA6C.py

@@ -1,3 +1,5 @@
+#!/usr/bin/env python
+
 #    Copyright (C) 2019-2021 Greenweaves Software Limited
 #
 #    This is free software: you can redistribute it and/or modify
@@ -35,9 +37,9 @@ def parse_permutations(text):
                 depth -= 1
                 i1     = i
                 Permutations.append([int(j) for j in text[i0+1:i1-1].split()])
-    
+
     return Permutations
-    
+
 if __name__=='__main__':
 
     start = time.time()
@@ -48,7 +50,7 @@ def parse_permutations(text):
     if args.sample:
         print (d2break([[+1, +2, +3, +4, +5, +6]],
                        [[+1, -3, -6, -5],[+2, -4]]))
-               
+
     if args.rosalind:
         Input  = read_strings(f'data/rosalind_{os.path.basename(__file__).split(".")[0]}.txt')
         Perms  = [parse_permutations(i) for i in Input]
@@ -57,5 +59,5 @@ def parse_permutations(text):
     elapsed = time.time() - start
     minutes = int(elapsed/60)
     seconds = elapsed - 60*minutes
-    print (f'Elapsed Time {minutes} m {seconds:.2f} s')  
-         
+    print (f'Elapsed Time {minutes} m {seconds:.2f} s')
+

BA6D.py

@@ -1,3 +1,5 @@
+#!/usr/bin/env python
+
 # Copyright (C) 2019-2021 Greenweaves Software Limited
 
 # This is free software: you can redistribute it and/or modify
@@ -13,7 +15,7 @@
 # You should have received a copy of the GNU General Public License
 # along with this program.  If not, see <http://www.gnu.org/licenses/>
 
-# BA6D Find a Shortest Transformation of One Genome into Another by 2-Breaks 
+# BA6D Find a Shortest Transformation of One Genome into Another by 2-Breaks
 
 import argparse
 import os
@@ -39,7 +41,7 @@ def get2_breaks(Configuration):
                     i1,j1 = Configuration[l]
                     result.append((i0,j0,i1,j1))
           return result
-     
+
      def FindShortestTransformationCycles(s,t):
           assert sorted(s)== sorted(t)
           ColouredS     = ColouredEdges(s)
@@ -61,7 +63,7 @@ def FindShortestTransformationCycles(s,t):
                Config,score,path = leader_board[0]
                if score==0:
                     return path,Blacks
-     
+
      return FindShortestTransformationCycles(ChromosomeToCycle(s),ChromosomeToCycle(t))
 
 def CycleToChromosome1(Blacks,Coloured):
@@ -89,7 +91,7 @@ def CycleToChromosome1(Blacks,Coloured):
           #print (len(paths))
           for Coloured in paths:
                #print (Coloured)
-               print (CycleToChromosome1(Blacks,Coloured))          
+               print (CycleToChromosome1(Blacks,Coloured))
 
 
 
@@ -105,5 +107,4 @@ def CycleToChromosome1(Blacks,Coloured):
      elapsed = time.time() - start
      minutes = int(elapsed/60)
      seconds = elapsed - 60*minutes
-     print (f'Elapsed Time {minutes} m {seconds:.2f} s')  
-
+     print (f'Elapsed Time {minutes} m {seconds:.2f} s')

BA6F.py

@@ -1,3 +1,5 @@
+#!/usr/bin/env python
+
 #    Copyright (C) 2019 Greenweaves Software Limited
 #
 #    This is free software: you can redistribute it and/or modify
@@ -18,4 +20,4 @@
 from fragile import ChromosomeToCycle
 
 if __name__=='__main__':
-    print (ChromosomeToCycle([-1, -2, -3, -4, +5, -6, +7, +8, +9, -10, -11, +12, -13, +14, -15, +16, +17, -18, -19, -20, -21, -22, +23, +24, -25, +26, -27, -28, -29, -30, -31, -32, -33, +34, +35, +36, -37, +38, +39, -40, +41, -42, -43, +44, +45, +46, -47, +48, -49, -50, +51, +52, -53, +54, +55, +56, -57, +58, -59, -60, -61, -62, +63, +64, +65, +66, +67, +68]))
+    print (ChromosomeToCycle([-1, -2, -3, -4, +5, -6, +7, +8, +9, -10, -11, +12, -13, +14, -15, +16, +17, -18, -19, -20, -21, -22, +23, +24, -25, +26, -27, -28, -29, -30, -31, -32, -33, +34, +35, +36, -37, +38, +39, -40, +41, -42, -43, +44, +45, +46, -47, +48, -49, -50, +51, +52, -53, +54, +55, +56, -57, +58, -59, -60, -61, -62, +63, +64, +65, +66, +67, +68]))